|
ATCC
lactobacillus gasseri atcc 33323 Lactobacillus Gasseri Atcc 33323, supplied by ATCC, used in various techniques. Bioz Stars score: 98/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/lactobacillus gasseri atcc 33323/product/ATCC Average 98 stars, based on 1 article reviews
lactobacillus gasseri atcc 33323 - by Bioz Stars,
2026-03
98/100 stars
|
Buy from Supplier |
|
ATCC
reference lactobacillus strains Reference Lactobacillus Strains, supplied by ATCC, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/reference lactobacillus strains/product/ATCC Average 95 stars, based on 1 article reviews
reference lactobacillus strains - by Bioz Stars,
2026-03
95/100 stars
|
Buy from Supplier |
|
ATCC
lab strains ![]() Lab Strains, supplied by ATCC, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/lab strains/product/ATCC Average 93 stars, based on 1 article reviews
lab strains - by Bioz Stars,
2026-03
93/100 stars
|
Buy from Supplier |
|
ATCC
l gasseri ![]() L Gasseri, supplied by ATCC, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/l gasseri/product/ATCC Average 97 stars, based on 1 article reviews
l gasseri - by Bioz Stars,
2026-03
97/100 stars
|
Buy from Supplier |
|
ATCC
lactobacilli ![]() Lactobacilli, supplied by ATCC, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/lactobacilli/product/ATCC Average 96 stars, based on 1 article reviews
lactobacilli - by Bioz Stars,
2026-03
96/100 stars
|
Buy from Supplier |
|
ATCC
glucose od600 ![]() Glucose Od600, supplied by ATCC, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/glucose od600/product/ATCC Average 99 stars, based on 1 article reviews
glucose od600 - by Bioz Stars,
2026-03
99/100 stars
|
Buy from Supplier |
|
ATCC
bacteroidetes catgtggtttaattcgatgat agctgacgacaaccatgcag bacteroides vulgatus atcc ![]() Bacteroidetes Catgtggtttaattcgatgat Agctgacgacaaccatgcag Bacteroides Vulgatus Atcc, supplied by ATCC, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/bacteroidetes catgtggtttaattcgatgat agctgacgacaaccatgcag bacteroides vulgatus atcc/product/ATCC Average 97 stars, based on 1 article reviews
bacteroidetes catgtggtttaattcgatgat agctgacgacaaccatgcag bacteroides vulgatus atcc - by Bioz Stars,
2026-03
97/100 stars
|
Buy from Supplier |
|
ATCC
lactobacillus gasseri atcc 33323 lactobacillus gasseri atcc 33323 gc00445 ![]() Lactobacillus Gasseri Atcc 33323 Lactobacillus Gasseri Atcc 33323 Gc00445, supplied by ATCC, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/lactobacillus gasseri atcc 33323 lactobacillus gasseri atcc 33323 gc00445/product/ATCC Average 90 stars, based on 1 article reviews
lactobacillus gasseri atcc 33323 lactobacillus gasseri atcc 33323 gc00445 - by Bioz Stars,
2026-03
90/100 stars
|
Buy from Supplier |
|
ATCC
777 744 714 687 l crispatus atcc ![]() 777 744 714 687 L Crispatus Atcc, supplied by ATCC, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/777 744 714 687 l crispatus atcc/product/ATCC Average 95 stars, based on 1 article reviews
777 744 714 687 l crispatus atcc - by Bioz Stars,
2026-03
95/100 stars
|
Buy from Supplier |
|
ATCC
plasmid ptrk668 ![]() Plasmid Ptrk668, supplied by ATCC, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/plasmid ptrk668/product/ATCC Average 99 stars, based on 1 article reviews
plasmid ptrk668 - by Bioz Stars,
2026-03
99/100 stars
|
Buy from Supplier |
|
ATCC
116629653 lgas 1011 563 bacteria firmicutes lactobacillus gasseri atcc 33323 fibronectin ![]() 116629653 Lgas 1011 563 Bacteria Firmicutes Lactobacillus Gasseri Atcc 33323 Fibronectin, supplied by ATCC, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/result/116629653 lgas 1011 563 bacteria firmicutes lactobacillus gasseri atcc 33323 fibronectin/product/ATCC Average 95 stars, based on 1 article reviews
116629653 lgas 1011 563 bacteria firmicutes lactobacillus gasseri atcc 33323 fibronectin - by Bioz Stars,
2026-03
95/100 stars
|
Buy from Supplier |
Image Search Results
Journal: Applied and Environmental Microbiology
Article Title: The insertion of the inverted repeat of an insertion sequence (IS) element from Lacticaseibacillus rhamnosus changes the host range and stability of pGK12, a shuttle vector for lactic acid bacteria
doi: 10.1128/aem.01908-24
Figure Lengend Snippet: Plasmids used in this study
Article Snippet: The segregational stability of pGK12, pTRK829, and pTRK830 was tested in six different
Techniques: Plasmid Preparation, Expressing, Clone Assay
Journal:
Article Title: In Vitro Adhesion Specificity of Indigenous Lactobacilli within the Avian Intestinal Tract
doi: 10.1128/AEM.68.10.5155-5159.2002
Figure Lengend Snippet: Adherence of chicken-associated lactobacilli isolates to immobilized ileal mucus. Adherence to mucus preparations is shown by filled symbols, and the adherence to type IV collagen is shown by open symbols. (A) Adherence of L. crispatus strains ST1 (•), A33 (▾), 134mi (▪), and ATCC 33820 (⧫). (B) Adherence of L. reuteri strains CT7 (•) and ATCC 53609 (▾). (C) Adherence of L. gasseri strains CT5 (•) and ATCC 33323 (▾). (D) For comparison, the adhesion by strains 1063 of L. reuteri (•) and ATCC 393 of L. casei (▾) are shown.
Article Snippet: The strains ATCC 33323 of
Techniques: Comparison
Journal:
Article Title: Supplementation of the Diet with High-Viscosity Beta-Glucan Results in Enrichment for Lactobacilli in the Rat Cecum
doi: 10.1128/AEM.72.3.1925-1931.2006
Figure Lengend Snippet: Utilization by lactobacilli of β-glucan hydrolysate enriched for DP3 and DP4 oligosaccharides (72 h of anaerobic incubation at 37°C) a
Article Snippet: The utilization of oligosaccharides in β-glucan hydrolysates was measured by the culture of strains of
Techniques: Incubation
Journal:
Article Title: Identification and Cloning of gusA , Encoding a New ?-Glucuronidase from Lactobacillus gasseri ADH
doi: 10.1128/AEM.67.3.1253-1261.2001
Figure Lengend Snippet: Bacterial strains and plasmids
Article Snippet: Further confirmation of one clone, designated pTRK666, was obtained by subcloning its 4.5-kb insert as an Eco RI- Pst I fragment into the gram-positive shuttle vector, pTRK563, and introducting the resulting
Techniques: Plasmid Preparation, Expressing, Clone Assay