l gasseri atcc 33323 Search Results


98
ATCC lactobacillus gasseri atcc 33323
Lactobacillus Gasseri Atcc 33323, supplied by ATCC, used in various techniques. Bioz Stars score: 98/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/lactobacillus gasseri atcc 33323/product/ATCC
Average 98 stars, based on 1 article reviews
lactobacillus gasseri atcc 33323 - by Bioz Stars, 2026-03
98/100 stars
  Buy from Supplier

95
ATCC reference lactobacillus strains
Reference Lactobacillus Strains, supplied by ATCC, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/reference lactobacillus strains/product/ATCC
Average 95 stars, based on 1 article reviews
reference lactobacillus strains - by Bioz Stars, 2026-03
95/100 stars
  Buy from Supplier

93
ATCC lab strains
Plasmids used in this study
Lab Strains, supplied by ATCC, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/lab strains/product/ATCC
Average 93 stars, based on 1 article reviews
lab strains - by Bioz Stars, 2026-03
93/100 stars
  Buy from Supplier

97
ATCC l gasseri
Adherence of chicken-associated lactobacilli isolates to immobilized ileal mucus. Adherence to mucus preparations is shown by filled symbols, and the adherence to type IV collagen is shown by open symbols. (A) Adherence of L. crispatus strains ST1 (•), A33 (▾), 134mi (▪), <t>and</t> <t>ATCC</t> 33820 (⧫). (B) Adherence of L. reuteri strains CT7 (•) and ATCC 53609 (▾). (C) Adherence of L. <t>gasseri</t> strains CT5 (•) and ATCC 33323 (▾). (D) For comparison, the adhesion by strains 1063 of L. reuteri (•) and ATCC 393 of L. casei (▾) are shown.
L Gasseri, supplied by ATCC, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/l gasseri/product/ATCC
Average 97 stars, based on 1 article reviews
l gasseri - by Bioz Stars, 2026-03
97/100 stars
  Buy from Supplier

96
ATCC lactobacilli
Utilization by <t> lactobacilli </t> of β-glucan hydrolysate enriched for DP3 and DP4 oligosaccharides (72 h of anaerobic incubation at 37°C) a
Lactobacilli, supplied by ATCC, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/lactobacilli/product/ATCC
Average 96 stars, based on 1 article reviews
lactobacilli - by Bioz Stars, 2026-03
96/100 stars
  Buy from Supplier

99
ATCC glucose od600
Utilization by <t> lactobacilli </t> of β-glucan hydrolysate enriched for DP3 and DP4 oligosaccharides (72 h of anaerobic incubation at 37°C) a
Glucose Od600, supplied by ATCC, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/glucose od600/product/ATCC
Average 99 stars, based on 1 article reviews
glucose od600 - by Bioz Stars, 2026-03
99/100 stars
  Buy from Supplier

97
ATCC bacteroidetes catgtggtttaattcgatgat agctgacgacaaccatgcag bacteroides vulgatus atcc
Utilization by <t> lactobacilli </t> of β-glucan hydrolysate enriched for DP3 and DP4 oligosaccharides (72 h of anaerobic incubation at 37°C) a
Bacteroidetes Catgtggtttaattcgatgat Agctgacgacaaccatgcag Bacteroides Vulgatus Atcc, supplied by ATCC, used in various techniques. Bioz Stars score: 97/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/bacteroidetes catgtggtttaattcgatgat agctgacgacaaccatgcag bacteroides vulgatus atcc/product/ATCC
Average 97 stars, based on 1 article reviews
bacteroidetes catgtggtttaattcgatgat agctgacgacaaccatgcag bacteroides vulgatus atcc - by Bioz Stars, 2026-03
97/100 stars
  Buy from Supplier

90
ATCC lactobacillus gasseri atcc 33323 lactobacillus gasseri atcc 33323 gc00445
Utilization by <t> lactobacilli </t> of β-glucan hydrolysate enriched for DP3 and DP4 oligosaccharides (72 h of anaerobic incubation at 37°C) a
Lactobacillus Gasseri Atcc 33323 Lactobacillus Gasseri Atcc 33323 Gc00445, supplied by ATCC, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/lactobacillus gasseri atcc 33323 lactobacillus gasseri atcc 33323 gc00445/product/ATCC
Average 90 stars, based on 1 article reviews
lactobacillus gasseri atcc 33323 lactobacillus gasseri atcc 33323 gc00445 - by Bioz Stars, 2026-03
90/100 stars
  Buy from Supplier

95
ATCC 777 744 714 687 l crispatus atcc
Utilization by <t> lactobacilli </t> of β-glucan hydrolysate enriched for DP3 and DP4 oligosaccharides (72 h of anaerobic incubation at 37°C) a
777 744 714 687 L Crispatus Atcc, supplied by ATCC, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/777 744 714 687 l crispatus atcc/product/ATCC
Average 95 stars, based on 1 article reviews
777 744 714 687 l crispatus atcc - by Bioz Stars, 2026-03
95/100 stars
  Buy from Supplier

99
ATCC plasmid ptrk668
Bacterial strains and plasmids
Plasmid Ptrk668, supplied by ATCC, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/plasmid ptrk668/product/ATCC
Average 99 stars, based on 1 article reviews
plasmid ptrk668 - by Bioz Stars, 2026-03
99/100 stars
  Buy from Supplier

95
ATCC 116629653 lgas 1011 563 bacteria firmicutes lactobacillus gasseri atcc 33323 fibronectin
Bacterial strains and plasmids
116629653 Lgas 1011 563 Bacteria Firmicutes Lactobacillus Gasseri Atcc 33323 Fibronectin, supplied by ATCC, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
https://www.bioz.com/result/116629653 lgas 1011 563 bacteria firmicutes lactobacillus gasseri atcc 33323 fibronectin/product/ATCC
Average 95 stars, based on 1 article reviews
116629653 lgas 1011 563 bacteria firmicutes lactobacillus gasseri atcc 33323 fibronectin - by Bioz Stars, 2026-03
95/100 stars
  Buy from Supplier

Image Search Results


Plasmids used in this study

Journal: Applied and Environmental Microbiology

Article Title: The insertion of the inverted repeat of an insertion sequence (IS) element from Lacticaseibacillus rhamnosus changes the host range and stability of pGK12, a shuttle vector for lactic acid bacteria

doi: 10.1128/aem.01908-24

Figure Lengend Snippet: Plasmids used in this study

Article Snippet: The segregational stability of pGK12, pTRK829, and pTRK830 was tested in six different LAB strains (LGG, L. casei ATCC 393, L. paracasei ATCC 25598, L. paracasei ATCC 334, L. gasseri ATCC 33323, and L. johnsonii ATCC 11506) under non-selective conditions.

Techniques: Plasmid Preparation, Expressing, Clone Assay

Adherence of chicken-associated lactobacilli isolates to immobilized ileal mucus. Adherence to mucus preparations is shown by filled symbols, and the adherence to type IV collagen is shown by open symbols. (A) Adherence of L. crispatus strains ST1 (•), A33 (▾), 134mi (▪), and ATCC 33820 (⧫). (B) Adherence of L. reuteri strains CT7 (•) and ATCC 53609 (▾). (C) Adherence of L. gasseri strains CT5 (•) and ATCC 33323 (▾). (D) For comparison, the adhesion by strains 1063 of L. reuteri (•) and ATCC 393 of L. casei (▾) are shown.

Journal:

Article Title: In Vitro Adhesion Specificity of Indigenous Lactobacilli within the Avian Intestinal Tract

doi: 10.1128/AEM.68.10.5155-5159.2002

Figure Lengend Snippet: Adherence of chicken-associated lactobacilli isolates to immobilized ileal mucus. Adherence to mucus preparations is shown by filled symbols, and the adherence to type IV collagen is shown by open symbols. (A) Adherence of L. crispatus strains ST1 (•), A33 (▾), 134mi (▪), and ATCC 33820 (⧫). (B) Adherence of L. reuteri strains CT7 (•) and ATCC 53609 (▾). (C) Adherence of L. gasseri strains CT5 (•) and ATCC 33323 (▾). (D) For comparison, the adhesion by strains 1063 of L. reuteri (•) and ATCC 393 of L. casei (▾) are shown.

Article Snippet: The strains ATCC 33323 of L. gasseri, ATCC 53609 of L. reuteri , and ATCC 393 of L. casei showed only poor adhesiveness to the chicken tissue (data not shown). fig ft0 fig mode=article f1 fig/graphic|fig/alternatives/graphic mode="anchored" m1 Open in a separate window FIG. 1. caption a7 Adherence of L. crispatus strains ST1 (AI through FI) and ATCC 33820 (GI) to regions of the chicken alimentary tract.

Techniques: Comparison

Utilization by  lactobacilli  of β-glucan hydrolysate enriched for DP3 and DP4 oligosaccharides (72 h of anaerobic incubation at 37°C) a

Journal:

Article Title: Supplementation of the Diet with High-Viscosity Beta-Glucan Results in Enrichment for Lactobacilli in the Rat Cecum

doi: 10.1128/AEM.72.3.1925-1931.2006

Figure Lengend Snippet: Utilization by lactobacilli of β-glucan hydrolysate enriched for DP3 and DP4 oligosaccharides (72 h of anaerobic incubation at 37°C) a

Article Snippet: The utilization of oligosaccharides in β-glucan hydrolysates was measured by the culture of strains of lactobacilli ( L. acidophilus ATCC 4356 T , Lactobacillus crispatus ATCC 33820 T , Lactobacillus gasseri ATCC 33323 T , Lactobacillus johnsonii ATCC 33200 T , Lactobacillus hamsteri ATCC 43851 T , and Lactobacillus ruminis strains ATCC 27780 T , ATCC 27781, and ATCC 27782) in peptone-yeast extract medium supplemented with vitamin K-hemin, Tween 80, and l -cysteine ( 21 ) and containing a 2% (wt/vol) concentration of hydrolysate.

Techniques: Incubation

Bacterial strains and plasmids

Journal:

Article Title: Identification and Cloning of gusA , Encoding a New ?-Glucuronidase from Lactobacillus gasseri ADH

doi: 10.1128/AEM.67.3.1253-1261.2001

Figure Lengend Snippet: Bacterial strains and plasmids

Article Snippet: Further confirmation of one clone, designated pTRK666, was obtained by subcloning its 4.5-kb insert as an Eco RI- Pst I fragment into the gram-positive shuttle vector, pTRK563, and introducting the resulting plasmid (pTRK668) into L. gasseri ATCC 33323 by electroporation.

Techniques: Plasmid Preparation, Expressing, Clone Assay